pCW57.1_SPTLC1_WT
(Plasmid #181920)

• Purpose: 3rd generation, Inducible lentiviral plasmid for expression of human wildtype SPTLC1
• Depositing Lab: Christian Metallo
• Publication: Cordes et al J Lipid Res. 2022 Sep 14:100281. doi: 10.1016/j.jlr.2022.100281.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: Addgene Plasmid #41393
• Backbone size w/o insert (bp): 9354
• Total vector size (bp): 9057
• Vector type: Mammalian Expression, Lentiviral ; Mammalian expression, , Doxycycline inducible
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Human serine palmitoyltransferase, long chain base subunit 1 (SPTLC1),
• Alt name: SPTLC1
• Alt name: Also known as HSN1; LBC1; LCB1; SPT1; SPTI; HSAN1
• Species: H. sapiens (human)
• Insert Size (bp): 1420
• GenBank ID: Gene ID: 10558 NM_006415
• Entrez Gene: SPTLC1 (a.k.a. HSAN1, HSN1, LBC1, LCB1, SPT1, SPTI)
• Promoter: tight TRE promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NHeI (unknown if destroyed)
• 3′ cloning site: AgeI (unknown if destroyed)
• 5′ sequencing primer: LNCX
• 3′ sequencing primer: TGAAACGCCGAGTTACACGA

Resource Information

• Supplemental Documents:
  • protein sequence differences between WT vs mutant C133W vs mutant C133Y SPTLC1 sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry