-
PurposeLentiviral plasmid that directs the expression of NFE2L2/Nrf2 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti-CMV-Puro-DEST
- Backbone size w/o insert (bp) 7999
- Total vector size (bp) 9817
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNFE2L2
-
Alt nameNRF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1818
-
Entrez GeneNFE2L2 (a.k.a. HEBP1, IMDDHH, NRF2, Nrf-2)
- Promoter SFFV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CTCACGGGGATTTCCAAGTC
- 3′ sequencing primer CATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a 15 base pair deletion at the attB1 site and a 14 base pair deletion at the attB2 site compared to the depositor's provided sequence. These differences are not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-NFE2L2-Puro was a gift from Scott Dixon (Addgene plasmid # 181919 ; http://n2t.net/addgene:181919 ; RRID:Addgene_181919) -
For your References section:
Ferroptosis regulation by the NGLY1/NFE2L1 pathway. Forcina GC, Pope L, Murray M, Dong W, Abu-Remaileh M, Bertozzi CR, Dixon SJ. Proc Natl Acad Sci U S A. 2022 Mar 15;119(11):e2118646119. doi: 10.1073/pnas.2118646119. Epub 2022 Mar 10. 10.1073/pnas.2118646119 PubMed 35271393