Skip to main content
Addgene

pLenti-CMV-NFE2L2-Puro
(Plasmid #181919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181919 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-CMV-Puro-DEST
  • Backbone size w/o insert (bp) 7999
  • Total vector size (bp) 9817
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NFE2L2
  • Alt name
    NRF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1818
  • Entrez Gene
    NFE2L2 (a.k.a. HEBP1, IMDDHH, NRF2, Nrf-2)
  • Promoter SFFV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CTCACGGGGATTTCCAAGTC
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a 15 base pair deletion at the attB1 site and a 14 base pair deletion at the attB2 site compared to the depositor's provided sequence. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-NFE2L2-Puro was a gift from Scott Dixon (Addgene plasmid # 181919 ; http://n2t.net/addgene:181919 ; RRID:Addgene_181919)
  • For your References section:

    Ferroptosis regulation by the NGLY1/NFE2L1 pathway. Forcina GC, Pope L, Murray M, Dong W, Abu-Remaileh M, Bertozzi CR, Dixon SJ. Proc Natl Acad Sci U S A. 2022 Mar 15;119(11):e2118646119. doi: 10.1073/pnas.2118646119. Epub 2022 Mar 10. 10.1073/pnas.2118646119 PubMed 35271393