pTwist-SFFV-NFE2L1-Puro
(Plasmid #181917)

• Purpose: Lentiviral plasmid that directs the expression of NFE2L1/Nrf1 in mammalian cells.
• Depositing Lab: Scott Dixon
• Publication: Forcina et al Proc Natl Acad Sci U S A. 2022 Mar 15;119(11):e2118646119. doi: 10.1073/pnas.2118646119. Epub 2022 Mar 10.

Backbone

• Vector backbone: pTwist-SFFV-Puro
• Backbone manufacturer: Twist Biosciences
• Backbone size w/o insert (bp): 7510
• Total vector size (bp): 9847
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NFE2L1
• Alt name: NRF1
• Species: H. sapiens (human)
• Insert Size (bp): 2337
• Entrez Gene: NFE2L1 (a.k.a. LCR-F1, NRF-1, NRF1, TCF11)
• Promoter: SFFV
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: gcttctcgcttctgttcgcg
• 3′ sequencing primer: caccggccttattccaagcg

Resource Information

• Supplemental Documents:
  • pTwist_FLAG_NFE2L1_HA.gb
• A portion of this plasmid was derived from a plasmid made by: Custom synthesis from Twist Biosciences

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry