Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-CMV-NGLY1-Puro
(Plasmid #181916)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 181916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti-CMV-Puro-DEST
  • Backbone size w/o insert (bp) 7915
  • Total vector size (bp) 9880
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N-glycanase 1
  • Alt name
    NGLY1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1965
  • Entrez Gene
    NGLY1 (a.k.a. CDDG, CDG1V, PNG-1, PNG1, PNGase)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCACGGGGATTTCCAAGTC
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-NGLY1-Puro was a gift from Scott Dixon (Addgene plasmid # 181916 ; http://n2t.net/addgene:181916 ; RRID:Addgene_181916)
  • For your References section:

    Ferroptosis regulation by the NGLY1/NFE2L1 pathway. Forcina GC, Pope L, Murray M, Dong W, Abu-Remaileh M, Bertozzi CR, Dixon SJ. Proc Natl Acad Sci U S A. 2022 Mar 15;119(11):e2118646119. doi: 10.1073/pnas.2118646119. Epub 2022 Mar 10. 10.1073/pnas.2118646119 PubMed 35271393