pAAV-EGFP.T2A.NCLX.3'UTR
(Plasmid
#181872)
-
PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CAG
-
Vector typeMammalian Expression, Adenoviral, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesolute carrier family 8 member B1
-
Alt nameNCLX
-
Alt namesodium/calcium/lithium exchanger
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1755
-
Mutationincludes a large portion of the Slc8b1 3'UTR downstream of the CDS
-
GenBank IDNM_133221
-
Entrez GeneSlc8b1 (a.k.a. AF261233, NCKX6, NCLX, Slc24a6)
- Promoter synthetic hybrid CAG promoter
-
Tag
/ Fusion Protein
- myc (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTG
- 3′ sequencing primer ACGGGAAGCAATAGCATGATAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Alt nameenhanced GFP
-
Insert Size (bp)717
- Promoter synthetic hybrid CAG promoter
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- T2A (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert name3'UTR of solute carrier family 8 member B1
-
Alt nameNCLX 3'UTR
-
Alt namesodium/calcium/lithium exchanger 3'UTR
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)774
-
Mutationthe last 212 nucleotides of the 3'UTR are not included in the sequence
-
GenBank IDNM_133221
- Promoter synthetic hybrid CAG promoter
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer none
- 3′ sequencing primer ACGGGAAGCAATAGCATGATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIsrael Sekler, Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EGFP.T2A.NCLX.3'UTR was a gift from Hilmar Bading (Addgene plasmid # 181872 ; http://n2t.net/addgene:181872 ; RRID:Addgene_181872) -
For your References section:
Disrupted expression of mitochondrial NCLX sensitizes neuroglial networks to excitotoxic stimuli and renders synaptic activity toxic. Hagenston AM, Yan J, Bas-Orth C, Tan Y, Sekler I, Bading H. J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508. 10.1016/j.jbc.2021.101508 PubMed 34942149