pAAV-MCU-EGFP
(Plasmid #181866)

• Purpose: Expresses GFP-tagged mitochondrial calcium uniporter (MCU) under control of the CaMKIIa promoter
• Depositing Lab: Hilmar Bading
• Publication: Qiu et al Nat Commun. 2013;4:2034. doi: 10.1038/ncomms3034.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-CaMKIIa
• Vector type: Mammalian Expression, Adenoviral, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mitochondrial calcium uniporter
• Alt name: MCU
• Species: M. musculus (mouse)
• Insert Size (bp): 1059
• GenBank ID: NM_001033259.4
• Entrez Gene: Mcu (a.k.a. 2010012O16Rik, C10orf42, Ccdc109a, D130073L02Rik, Gm64)
• Promoter: CaMKIIa
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: TGGGGACCTGGATGCTGACGAA
• 3′ sequencing primer: ACGGGAAGCAATAGCATGATAC

Resource Information

• Supplemental Documents:
  • 288_CKIIa-MCU.EGFP.gbk
• A portion of this plasmid was derived from a plasmid made by: Origene, MC212635

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry