Skip to main content
Addgene

pcDNA3.1-Muc5b D1 (murine) with cleavable His tag
(Plasmid #181814)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181814 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Muc5b D1
  • Alt name
    Mucin 5b D1
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_028801.2
  • Entrez Gene
    Muc5b (a.k.a. 2300002I04Rik, A130042M24, AV085033, MUC5, MUC9, mucin 5b)
  • Promoter CMV
  • Tag / Fusion Protein
    • TEV cleavage site followed by 6xHistidine tag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

6XHistidine tag on the N' terminal side followed by a TEV cleavage site was not cleaved by TEV when tested. Therefore, this version of 6xHistidine tag on the C' terminal side was used.
Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474741v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-Muc5b D1 (murine) with cleavable His tag was a gift from Deborah Fass (Addgene plasmid # 181814 ; http://n2t.net/addgene:181814 ; RRID:Addgene_181814)

  • For your References section:

    Intestinal mucin is a chaperone of multivalent copper. Reznik N, Gallo AD, Rush KW, Javitt G, Fridmann-Sirkis Y, Ilani T, Nairner NA, Fishilevich S, Gokhman D, Chacon KN, Franz KJ, Fass D. Cell. 2022 Oct 27;185(22):4206-4215.e11. doi: 10.1016/j.cell.2022.09.021. Epub 2022 Oct 6. 10.1016/j.cell.2022.09.021 PubMed 36206754
Related items:
Commonly requested with: