Skip to main content
Addgene

pDonor14-ShoHELIX-KanR (BO4)
(Plasmid #181795)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181795 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19, R6K origin of replication
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    KanR, R6K origin of replication
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgacgccgttggatacaccaagg
  • 3′ sequencing primer ttgagtgacacaggaacacttaac
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDonor14-ShoHELIX-KanR (BO4) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181795 ; http://n2t.net/addgene:181795 ; RRID:Addgene_181795)

  • For your References section:

    Precise cut-and-paste DNA insertion using engineered type V-K CRISPR-associated transposases. Tou CJ, Orr B, Kleinstiver BP. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01574-x. 10.1038/s41587-022-01574-x PubMed 36593413
Related items:
Commonly requested with: