pAcHELIX-sgRNA_entry (CJT94)
(Plasmid
#181783)
-
PurposeExpresses AcHELIX containing a nicking I-AniI fusion to AcTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenAniI-AcTnsB, AcTnsC, AcTniQ, AcCas12k
-
SpeciesSynthetic
-
MutationnAniI = K227M, F80K, L232K
- Promoter Lac and J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGCCAAGCTCCAAAACGATCTCA
- 3′ sequencing primer gctagcattatacctaggactgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.01.07.475005v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcHELIX-sgRNA_entry (CJT94) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181783 ; http://n2t.net/addgene:181783 ; RRID:Addgene_181783) -
For your References section:
Precise cut-and-paste DNA insertion using engineered type V-K CRISPR-associated transposases. Tou CJ, Orr B, Kleinstiver BP. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01574-x. 10.1038/s41587-022-01574-x PubMed 36593413
