pAAV-EF1α-DIO-SN
(Plasmid
#181741)
-
PurposeAAV vector for expressing SN
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5604
- Total vector size (bp) 6324
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperNova (monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation)
-
Alt nameSN
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter EF1alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
As descried above, SN was developed by Dr. Takeharu Nagai (Osaka University).
https://www.addgene.org/53234/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1α-DIO-SN was a gift from Yasunori Hayashi (Addgene plasmid # 181741 ; http://n2t.net/addgene:181741 ; RRID:Addgene_181741) -
For your References section:
Stepwise synaptic plasticity events drive the early phase of memory consolidation. Goto A, Bota A, Miya K, Wang J, Tsukamoto S, Jiang X, Hirai D, Murayama M, Matsuda T, McHugh TJ, Nagai T, Hayashi Y. Science. 2021 Nov 12;374(6569):857-863. doi: 10.1126/science.abj9195. Epub 2021 Nov 11. 10.1126/science.abj9195 PubMed 34762472