Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBad-mAmetrine
(Plasmid #18083)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18083 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBad/His B
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4100
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mAmetrine fluorescent proteins
  • Alt name
    Synthetic construct fluorescent protein mAmetrine gene
  • Species
    evolved fluorescent protein
  • Insert Size (bp)
    720
  • Mutation
    The fluorescent protein was inserted between XhoI and EcoR1 of pBad/His B. There is an extra 'C' after XhoI to avoid the frameshift.
  • GenBank ID
    EU024649
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad-mAmetrine was a gift from Robert Campbell (Addgene plasmid # 18083 ; http://n2t.net/addgene:18083 ; RRID:Addgene_18083)
  • For your References section:

    Fluorescent protein FRET pairs for ratiometric imaging of dual biosensors. Ai HW, Hazelwood KL, Davidson MW, Campbell RE. Nat Methods. 2008 May . 5(5):401-3. 10.1038/nmeth.1207 PubMed 18425137