pBad-mAmetrine
(Plasmid #18083)

• Purpose: Bacterial expression of mAmetrine fluorescent protein
• Depositing Lab: Robert Campbell
• Publication: Ai et al Nat Methods. 2008 May . 5(5):401-3.

Backbone

• Vector backbone: pBad/His B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4100
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mAmetrine fluorescent proteins
• Alt name: Synthetic construct fluorescent protein mAmetrine gene
• Species: evolved fluorescent protein
• Insert Size (bp): 720
• Mutation: The fluorescent protein was inserted between XhoI and EcoR1 of pBad/His B. There is an extra 'C' after XhoI to avoid the frameshift.
• GenBank ID: EU024649
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry