pEUK028
(Plasmid
#180826)
-
PurposeT7-inducible expression construct to produce SwGdmA (SWIT_RS16490) in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-15b
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5708
- Total vector size (bp) 6762
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSwGdmA
-
Alt nameSWIT_RS16490
-
SpeciesSynthetic; Sphingomonas wittichii RW1
-
Insert Size (bp)1062
-
Entrez GeneSWIT_RS16490 (a.k.a. SWIT_RS16490, Swit_3266)
- Promoter T7
-
Tag
/ Fusion Protein
- 6X His (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bysynthetic gene was codon-optimized for expression in E. coli and synthesized by Twist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEUK028 was a gift from Gregg Beckham (Addgene plasmid # 180826 ; http://n2t.net/addgene:180826 ; RRID:Addgene_180826) -
For your References section:
Discovery, characterization, and metabolic engineering of Rieske non-heme iron monooxygenases for guaiacol O-demethylation. Bleem A, Kuatsjah E, Presley GN, Hinchen DJ, Zahn M, Garcia DC, Michener WE, König G, Tornesakis K, Allemann MN, Giannone RJ, McGeehan JE, Beckham GT, Michener JK. Chem Catalysis, 2022 10.1016/j.checat.2022.04.019