pEUK028
(Plasmid #180826)

• Purpose: T7-inducible expression construct to produce SwGdmA (SWIT_RS16490) in E. coli
• Depositing Lab: Gregg Beckham
• Publication: Bleem et al Chem Catalysis, 2022

Backbone

• Vector backbone: pET-15b
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5708
• Total vector size (bp): 6762
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SwGdmA
• Alt name: SWIT_RS16490
• Species: Synthetic; Sphingomonas wittichii RW1
• Insert Size (bp): 1062
• Entrez Gene: SWIT_RS16490 (a.k.a. SWIT_RS16490, Swit_3266)
• Promoter: T7
• Tag / Fusion Protein:
  • 6X His (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pEUK028_pET15b_6xHis-SwGdmA.gb
• A portion of this plasmid was derived from a plasmid made by: synthetic gene was codon-optimized for expression in E. coli and synthesized by Twist Biosciences

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry