Skip to main content
Addgene

pHBS1449 SED1-Lenti
(Plasmid #180824)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180824 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti CMV Puro DEST (w118-1)
  • Backbone manufacturer
    Eric Campeau, Paul Kaufman (Addgene #17452)
  • Backbone size w/o insert (bp) 9628
  • Total vector size (bp) 9838
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SED1 osmosensor
  • Alt name
    mCerulean3-AtLEA4-5-Citrine
  • Species
    Synthetic
  • Insert Size (bp)
    1998
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGGCCGCCACTGTGCTGGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHBS1449 SED1-Lenti was a gift from Rajat Rohatgi (Addgene plasmid # 180824 ; http://n2t.net/addgene:180824 ; RRID:Addgene_180824)
  • For your References section:

    Intrinsically disordered protein biosensor tracks the physical-chemical effects of osmotic stress on cells. Cuevas-Velazquez CL, Vellosillo T, Guadalupe K, Schmidt HB, Yu F, Moses D, Brophy JAN, Cosio-Acosta D, Das A, Wang L, Jones AM, Covarrubias AA, Sukenik S, Dinneny JR. Nat Commun. 2021 Sep 14;12(1):5438. doi: 10.1038/s41467-021-25736-8. 10.1038/s41467-021-25736-8 PubMed 34521831