pHBS1449 SED1-Lenti
(Plasmid
#180824)
-
PurposeSED1 biosensor for stable integration and expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti CMV Puro DEST (w118-1)
-
Backbone manufacturerEric Campeau, Paul Kaufman (Addgene #17452)
- Backbone size w/o insert (bp) 9628
- Total vector size (bp) 9838
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSED1 osmosensor
-
Alt namemCerulean3-AtLEA4-5-Citrine
-
SpeciesSynthetic
-
Insert Size (bp)1998
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGGCCGCCACTGTGCTGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHBS1449 SED1-Lenti was a gift from Rajat Rohatgi (Addgene plasmid # 180824 ; http://n2t.net/addgene:180824 ; RRID:Addgene_180824) -
For your References section:
Intrinsically disordered protein biosensor tracks the physical-chemical effects of osmotic stress on cells. Cuevas-Velazquez CL, Vellosillo T, Guadalupe K, Schmidt HB, Yu F, Moses D, Brophy JAN, Cosio-Acosta D, Das A, Wang L, Jones AM, Covarrubias AA, Sukenik S, Dinneny JR. Nat Commun. 2021 Sep 14;12(1):5438. doi: 10.1038/s41467-021-25736-8. 10.1038/s41467-021-25736-8 PubMed 34521831