pHR-PD-1 (BTLA ITIM)-mGFP
(Plasmid
#180817)
-
PurposeExpression of human PD-1 with immunoreceptor tyrosine-based inhibitory motif (ITIM) from BTLA, fused to mEGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePD-1 (BTLA ITIM)
-
SpeciesH. sapiens (human)
-
Mutationreplaced PD-1-ITIM (VDYGEL) with BTLA-ITIM (IVYASL)
-
Entrez GenePDCD1 (a.k.a. AIMTBS, CD279, PD-1, PD1, SLEB2, hPD-1, hPD-l, hSLE1)
- Promoter SFFV
-
Tag
/ Fusion Protein
- mEGFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ccaatcagcctgcttctcgcttc
- 3′ sequencing primer ccagaggttgattatcgataagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-PD-1 (BTLA ITIM)-mGFP was a gift from Enfu Hui (Addgene plasmid # 180817 ; http://n2t.net/addgene:180817 ; RRID:Addgene_180817) -
For your References section:
Molecular features underlying differential SHP1/SHP2 binding of immune checkpoint receptors. Xu X, Masubuchi T, Cai Q, Zhao Y, Hui E. Elife. 2021 Nov 4;10. pii: 74276. doi: 10.7554/eLife.74276. 10.7554/eLife.74276 PubMed 34734802