Skip to main content
Addgene

pET28-His10-BTLAicd (AA190-289, Y226F, Y257F, Y282F)-TwinStrep
(Plasmid #180807)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180807 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    BTLAint (AA190-289, Y226F, Y257F, Y282F)-TwinStrep
  • Species
    H. sapiens (human)
  • Mutation
    BTLA (Y226F, Y257F, Y282F)
  • Entrez Gene
    BTLA (a.k.a. BTLA1, CD272)
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer gctagttattgctcagcgg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28-His10-BTLAicd (AA190-289, Y226F, Y257F, Y282F)-TwinStrep was a gift from Enfu Hui (Addgene plasmid # 180807 ; http://n2t.net/addgene:180807 ; RRID:Addgene_180807)

  • For your References section:

    PD-1 and BTLA regulate T cell signaling differentially and only partially through SHP1 and SHP2. Xu X, Hou B, Fulzele A, Masubuchi T, Zhao Y, Wu Z, Hu Y, Jiang Y, Ma Y, Wang H, Bennett EJ, Fu G, Hui E. J Cell Biol. 2020 Jun 1;219(6). pii: 151801. doi: 10.1083/jcb.201905085. 10.1083/jcb.201905085 PubMed 32437509
Related items: