Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR-BTLA (Y226F, Y243F, Y257F, Y282F)-mGFP
(Plasmid #180792)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180792 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BTLA (Y226F, Y243F, Y257F, Y282F)
  • Species
    H. sapiens (human)
  • Mutation
    BTLA (Y226F, Y243F, Y257F, Y282F)
  • Entrez Gene
    BTLA (a.k.a. BTLA1, CD272)
  • Promoter SFFV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ccaatcagcctgcttctcgcttc
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-BTLA (Y226F, Y243F, Y257F, Y282F)-mGFP was a gift from Enfu Hui (Addgene plasmid # 180792 ; http://n2t.net/addgene:180792 ; RRID:Addgene_180792)
  • For your References section:

    PD-1 and BTLA regulate T cell signaling differentially and only partially through SHP1 and SHP2. Xu X, Hou B, Fulzele A, Masubuchi T, Zhao Y, Wu Z, Hu Y, Jiang Y, Ma Y, Wang H, Bennett EJ, Fu G, Hui E. J Cell Biol. 2020 Jun 1;219(6). pii: 151801. doi: 10.1083/jcb.201905085. 10.1083/jcb.201905085 PubMed 32437509