Skip to main content
Addgene

UPB-lung (UPB2)
(Plasmid #180788)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180788 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAVrg-CAG-tdTomato-WPRE-SV40 (Addgene, Plasmid #59462)
  • Backbone manufacturer
    Edward Boyden
  • Backbone size w/o insert (bp) 6150
  • Total vector size (bp) 6483
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    humanized ChR2-H134R (partial)
  • Alt name
    hChR2-H134R
  • Species
    Synthetic
  • Insert Size (bp)
    333
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer catcgataccgtcgacacaggacaccgggtgcagtg
  • 3′ sequencing primer ctgctcgaagcggccgctggcacagtatgataaccctcg
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UPB-lung (UPB2) was a gift from Rui Chang (Addgene plasmid # 180788 ; http://n2t.net/addgene:180788 ; RRID:Addgene_180788)

  • For your References section:

    A multidimensional coding architecture of the vagal interoceptive system. Zhao Q, Yu CD, Wang R, Xu QJ, Dai Pra R, Zhang L, Chang RB. Nature. 2022 Mar;603(7903):878-884. doi: 10.1038/s41586-022-04515-5. Epub 2022 Mar 16. 10.1038/s41586-022-04515-5 PubMed 35296859
Related items:
Commonly requested with: