UPB-esophagus (UPB5)
(Plasmid #180783)

• Purpose: Unique Projection Barcode (UPB5)-Esophagus for Projection-seq
• Depositing Lab: Rui Chang
• Publication: Zhao et al Nature. 2022 Mar;603(7903):878-884. doi: 10.1038/s41586-022-04515-5. Epub 2022 Mar 16.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAVrg-CAG-tdTomato-WPRE-SV40 (Addgene, Plasmid #59462)
• Backbone manufacturer: Edward Boyden
• Backbone size w/o insert (bp): 6150
• Total vector size (bp): 6519
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hM3Dq ( partial )
• Alt name: CHRM3
• Alt name: CHRM3 cholinergic receptor muscarinic 3
• Species: H. sapiens (human)
• Insert Size (bp): 369
• Entrez Gene: CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: catcgataccgtcgacacagcaccatcctcaactcc
• 3′ sequencing primer: ctgctcgaagcggccgctccgcttagtgatctgacttc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry