UPB-esophagus (UPB5)
(Plasmid
#180783)
-
PurposeUnique Projection Barcode (UPB5)-Esophagus for Projection-seq
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVrg-CAG-tdTomato-WPRE-SV40 (Addgene, Plasmid #59462)
-
Backbone manufacturerEdward Boyden
- Backbone size w/o insert (bp) 6150
- Total vector size (bp) 6519
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehM3Dq ( partial )
-
Alt nameCHRM3
-
Alt nameCHRM3 cholinergic receptor muscarinic 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)369
-
Entrez GeneCHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer catcgataccgtcgacacagcaccatcctcaactcc
- 3′ sequencing primer ctgctcgaagcggccgctccgcttagtgatctgacttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UPB-esophagus (UPB5) was a gift from Rui Chang (Addgene plasmid # 180783 ; http://n2t.net/addgene:180783 ; RRID:Addgene_180783) -
For your References section:
A multidimensional coding architecture of the vagal interoceptive system. Zhao Q, Yu CD, Wang R, Xu QJ, Dai Pra R, Zhang L, Chang RB. Nature. 2022 Mar;603(7903):878-884. doi: 10.1038/s41586-022-04515-5. Epub 2022 Mar 16. 10.1038/s41586-022-04515-5 PubMed 35296859