pCAT526
(Plasmid #180513)

• Purpose: Plasmid expressing mammalian codon optimized wt PlmCasX, mNeonGreen, sgRNAv1 scaffold, and restriction sites to clone in new spacers
• Depositing Lab: Jennifer Doudna
• Publication: Tsuchida et al Mol Cell. 2022 Mar 17;82(6):1199-1209.e6. doi: 10.1016/j.molcel.2022.02.002. Epub 2022 Feb 25.

Backbone

• Vector backbone: pBLO62.5
• Backbone size w/o insert (bp): 4856
• Total vector size (bp): 8669
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CasX sgRNAv1
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTGTTAGAGAGATAATTGG

Gene/Insert 2

• Gene/Insert name: PlmCasX-2A-mNeonGreen
• Alt name: PlmCas12e
• Promoter: CAG
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)
  • 2x FLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGGGTTTAAGGGATGGTTGG

Resource Information

• Supplemental Documents:
  • pCAT526_PlmCasX-v1-mNeonGreen.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry