pLenti-gRNA-puro
(Plasmid #180426)

• Purpose: Expresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.
• Depositing Lab: Moshe Szyf
• Publication: Sapozhnikov et al Nat Commun. 2021 Sep 29;12(1):5711. doi: 10.1038/s41467-021-25991-9.

Backbone

• Vector backbone: pLenti_puro
• Backbone size w/o insert (bp): 6487
• Total vector size (bp): 6960
• Modifications to backbone: The CMV promoter in the original pLenti-puro (Addgene #39481) was removed with the restriction enzymes ClaI and BamHI followed by blunting and self-ligation.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gRNAscr
• Alt name: Universal mammalian negative control (scrambled) gRNA
• gRNA/shRNA sequence: GCACTACCAGAGCTAACTCA
• Insert Size (bp): 467
• Promoter: human U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: BGH-reverse

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid backbone was pLenti-puro (Addgene #39481) with the CMV promoter removed by ClaI and BamHI double digest followed by blunting and self-ligation/circularization. gRNA scaffold sequence was obtained from Prashant Mali et al (Science, 2013) and made by gene synthesis, TA-cloning into pCR™ 2.1-TOPO™ TA vector, and transfer to modified pLenti-puro using EcoRI.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry