Skip to main content
Addgene

AAV.CBA.YFP.miR-E_shAtxn1
(Plasmid #180387)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180387 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV.CBA.YFP.miR-E
  • Backbone size w/o insert (bp) 6337
  • Vector type
    AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shAtxn1
  • gRNA/shRNA sequence
    ACGAACTGAAGTTTCCAGAAAA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    97
  • Entrez Gene
    Atxn1 (a.k.a. 2900016G23Rik, Atx1, Gm10786, Sca1)
  • Promoter CBA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTACCTGAGCTACCAGTCC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV.CBA.YFP.miR-E_shAtxn1 was a gift from Huda Zoghbi (Addgene plasmid # 180387 ; http://n2t.net/addgene:180387 ; RRID:Addgene_180387)

  • For your References section:

    Dual targeting of brain region-specific kinases potentiates neurological rescue in Spinocerebellar ataxia type 1. Lee WS, Lavery L, Rousseaux MWC, Rutledge EB, Jang Y, Wan YW, Wu SR, Kim W, Al-Ramahi I, Rath S, Adamski CJ, Bondar VV, Tewari A, Soleimani S, Mota S, Yalamanchili HK, Orr HT, Liu Z, Botas J, Zoghbi HY. EMBO J. 2021 Apr 1;40(7):e106106. doi: 10.15252/embj.2020106106. Epub 2021 Mar 11. 10.15252/embj.2020106106 PubMed 33709453

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More
Related items: