pAR100
(Plasmid
#180377)
-
PurposepAR100 allows cloning of TCRα and TCRβ genes using restriction enzymes (AflII, ApaI, and SacII).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSELECT-GFPzeo-mcs
-
Backbone manufacturerInvivogen
- Backbone size w/o insert (bp) 4249
- Total vector size (bp) 7114
-
Modifications to backboneInserted two multiple cloning sites: one at NheI site (NheI, AflII, ApaI, AscI, BsiWI, BstZ17I, NruI, PstI, SacII, Nhe); another at EcoRI site (EcoRI, KpnI, XbaI, BamHI, SalI, EcoRI); Inserted CD8Aa from pORF9-hCD8Aa (InvivoGen) Inserted NFAT-Luciferase from pGL3-NFAT luciferase
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNFAT-Luciferase
-
Alt nameluc+
-
Speciesfirefly
-
Insert Size (bp)2142
- Promoter minimal promoter and an NFAT response element
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site kpnI (not destroyed)
- 3′ cloning site salI (not destroyed)
- 5′ sequencing primer ACTTGTGGGGTCCTTCTCCT
- 3′ sequencing primer AATCTCACGCAGGCAGTTCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehCD8A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)719
- Promoter hEF1-HTLV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer AGTGCAGGTGCCAGAACATT
- 3′ sequencing primer CTTAAGGACGTATCTCGCCGAAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInvivogen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAR100 was a gift from Alec Redwood (Addgene plasmid # 180377 ; http://n2t.net/addgene:180377 ; RRID:Addgene_180377) -
For your References section:
Abacavir inhibits but does not cause self-reactivity to HLA-B*57:01-restricted EBV specific T cell receptors. Sooda A, Rwandamuriye F, Wanjalla CN, Jing L, Koelle DM, Peters B, Leary S, Chopra A, Calderwood MA, Mallal SA, Pavlos R, Watson M, Phillips EJ, Redwood AJ. Commun Biol. 2022 Feb 16;5(1):133. doi: 10.1038/s42003-022-03058-9. 10.1038/s42003-022-03058-9 PubMed 35173258