Skip to main content
Addgene

MSCV-Arkadia C946S H948L
(Plasmid #180373)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180373 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MSCV-IRES-Thy1.1 DEST
  • Backbone size w/o insert (bp) 6395
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable ; Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arkadia
  • Alt name
    RNF111
  • Species
    M. musculus (mouse)
  • Mutation
    C946S H948L
  • Entrez Gene
    Rnf111 (a.k.a. ARK, Arkadia)
  • Promoter LTR promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI sticky end to 5' of Arkadia and BglII sticky end of MSCV (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGTCTCTCCCCCTTGAACCT
  • 3′ sequencing primer GGGGCGGAATTCGATATCAAGCT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains Arkadia isoform 3

Please note: Plasmid contains a D454N mutation in Arkadia. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Arkadia C946S H948L was a gift from Dan Littman (Addgene plasmid # 180373 ; http://n2t.net/addgene:180373 ; RRID:Addgene_180373)

  • For your References section:

    Arkadia-SKI/SnoN signaling differentially regulates TGF-beta-induced iTreg and Th17 cell differentiation. Xu H, Wu L, Nguyen HH, Mesa KR, Raghavan V, Episkopou V, Littman DR. J Exp Med. 2021 Nov 1;218(11). pii: 212614. doi: 10.1084/jem.20210777. Epub 2021 Sep 2. 10.1084/jem.20210777 PubMed 34473197
Related items: