Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MSCV-Arkadia
(Plasmid #180372)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180372 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV-IRES-Thy1.1 DEST
  • Backbone size w/o insert (bp) 6395
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable ; Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Arkadia
  • Alt name
    RNF111
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rnf111 (a.k.a. ARK, Arkadia)
  • Promoter LTR promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI sticky end to 5' of Arkadia and BglII sticky end of MSCV (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGTCTCTCCCCCTTGAACCT
  • 3′ sequencing primer GGGGCGGAATTCGATATCAAGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-Arkadia was a gift from Dan Littman (Addgene plasmid # 180372 ; http://n2t.net/addgene:180372 ; RRID:Addgene_180372)
  • For your References section:

    Arkadia-SKI/SnoN signaling differentially regulates TGF-beta-induced iTreg and Th17 cell differentiation. Xu H, Wu L, Nguyen HH, Mesa KR, Raghavan V, Episkopou V, Littman DR. J Exp Med. 2021 Nov 1;218(11). pii: 212614. doi: 10.1084/jem.20210777. Epub 2021 Sep 2. 10.1084/jem.20210777 PubMed 34473197