pSIN-Arkadia-gRNA6
(Plasmid
#180367)
-
Purposetargeting mouse Arkadia gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSIN
- Backbone size w/o insert (bp) 7099
- Total vector size (bp) 7058
-
Modifications to backboneThe retroviral sgRNA expression vector pSIN-U6-sgRNA-EF1as-Thy1.1-P2A-Neo was generated by mutating a pSIN vector backbone and the 5′ LTR to remove BbsI sites and assembling a hU6-BbsI-filler-BbsI-tracr EF1as-Thy1.1-P2A-Neo cassette downstream from the packaging signal
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable ; Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArkadia targeting gRNA
-
Alt nameRNF111
-
gRNA/shRNA sequenceGGAAAAGGTGCATACATGGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneRnf111 (a.k.a. ARK, Arkadia)
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO.1-5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIN-Arkadia-gRNA6 was a gift from Dan Littman (Addgene plasmid # 180367 ; http://n2t.net/addgene:180367 ; RRID:Addgene_180367) -
For your References section:
Arkadia-SKI/SnoN signaling differentially regulates TGF-beta-induced iTreg and Th17 cell differentiation. Xu H, Wu L, Nguyen HH, Mesa KR, Raghavan V, Episkopou V, Littman DR. J Exp Med. 2021 Nov 1;218(11). pii: 212614. doi: 10.1084/jem.20210777. Epub 2021 Sep 2. 10.1084/jem.20210777 PubMed 34473197