pYTK-DN5
(Plasmid #180286)

• Purpose: NatR multi-gene yeast expression vector (GFP-dropout)
• Depositing Lab: Andreas Milias-Argeitis
• Publication: Novarina et al STAR Protoc. 2022 Jun 10;3(2):101358. doi: 10.1016/j.xpro.2022.101358. eCollection 2022 Jun 17.

Backbone

• Vector backbone: pYTK084
• Backbone size w/o insert (bp): 1779
• Total vector size (bp): 4846
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: Nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ConLS' - GFP - ConRE' - NatR - CEN6/ARS4
• Species: Synthetic
• Insert Size (bp): 3067

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: gaattcgcatctagactgatg
• 3′ sequencing primer: gacggatcgcttgcctgtaac

Resource Information

• Supplemental Documents:
  • pYTK-DN5.gbk
• A portion of this plasmid was derived from a plasmid made by: A Highly-characterized Yeast Toolkit for Modular, Multi-part Assembly. Lee ME, DeLoache, WC A, Cervantes B, Dueber, JE. ACS Synthetic Biology 2015 DOI: 10.1021/sb500366v

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was obtained via Golden Gate assembly of plasmids: pYTK008 + pYTK047 + pYTK073 + pYTK078 + pYTK081 + pYTK084