pYTK-DN3
(Plasmid #180284)

• Purpose: Spacer cassette (TU2)
• Depositing Lab: Andreas Milias-Argeitis
• Publication: Novarina et al STAR Protoc. 2022 Jun 10;3(2):101358. doi: 10.1016/j.xpro.2022.101358. eCollection 2022 Jun 17.

Backbone

• Vector backbone: pYTK095
• Backbone size w/o insert (bp): 1874
• Total vector size (bp): 2278
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ConL1 - Spacer - ConR2
• Species: Synthetic
• Insert Size (bp): 404

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: acggggtcatcacggctcatc
• 3′ sequencing primer: ggctcacgtcttatttggg

Resource Information

• Supplemental Documents:
  • pYTK-DN3.gbk
• A portion of this plasmid was derived from a plasmid made by: A Highly-characterized Yeast Toolkit for Modular, Multi-part Assembly. Lee ME, DeLoache, WC A, Cervantes B, Dueber, JE. ACS Synthetic Biology 2015 DOI: 10.1021/sb500366v

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was obtained via Golden Gate assembly of plasmids: pYTK003 + pYTK048 + pYTK068 + pYTK095