pZR043_Lenti-U6-sgEGFR-MS2-PP7-hPGK-PCP-p65-HSF1-Puro
(Plasmid #180267)

• Purpose: Lentiviral expression vector for CRISPRa-SAM with EGFR targeting sgRNA
• Depositing Lab: Alexander Marson
• Publication: Schmidt et al Science. 2022 Feb 4;375(6580):eabj4008. doi: 10.1126/science.abj4008. Epub 2022 Feb 4.

Backbone

• Vector backbone: pXPR_502
• Total vector size (bp): 8689
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFR sgRNA
• Species: Synthetic
• Insert Size (bp): 20
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: gagggcctatttcccatgatt

Resource Information

• Supplemental Documents:
  • pZR043_Lenti-U6-sgEGFR-MS2-PP7-hPGK-PCP-p65-HSF1-Puro.gb
• A portion of this plasmid was derived from a plasmid made by: pXPR_502 was a gift from John Doench & David Root (Addgene plasmid # 96923)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry