pZR071_SFFV-dCas9-mCherry-KRAB
(Plasmid #180264)

• Purpose: Lentiviral expression vector for dCas9-KRAB in mammalian cells
• Depositing Lab: Alexander Marson
• Publication: Schmidt et al Science. 2022 Feb 4;375(6580):eabj4008. doi: 10.1126/science.abj4008. Epub 2022 Feb 4.

Backbone

• Vector backbone: pHR
• Total vector size (bp): 14176
• Modifications to backbone: TagBFP was switched for mCherry in pHR-SFFV-dCas9-BFP-KRAB
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9
• Species: S. Pyogenes
• Insert Size (bp): 4104
• Mutation: Nuclease dead Cas9
• Promoter: SFFV
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • KRAB (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ccaatcagcctgcttctcgc

Resource Information

• Supplemental Documents:
  • pZR071_SFFV-dCas9-mCherry-KRAB.gb
• A portion of this plasmid was derived from a plasmid made by: pHR-SFFV-dCas9-BFP-KRAB was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46911)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry