PD2529-CAG-Flag-mouse TGFb2
(Plasmid
#180261)
-
PurposeMouse full length TGFβ2 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepD2529 CAG
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTGFβ2
-
Alt nameTGFb2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1182
-
Entrez GeneTgfb2 (a.k.a. Tgf-beta2, Tgfb-2)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAA
- 3′ sequencing primer TGCCACAGATGTTACTTAGCCTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PD2529-CAG-Flag-mouse TGFb2 was a gift from Timothy Springer (Addgene plasmid # 180261 ; http://n2t.net/addgene:180261 ; RRID:Addgene_180261) -
For your References section:
Loss of LRRC33-dependent TGFbeta1 activation enhances anti-tumor immunity and checkpoint blockade therapy. Jiang A, Qin Y, Springer TA. Cancer Immunol Res. 2022 Feb 18. pii: 681626. doi: 10.1158/2326-6066.CIR-21-0593. 10.1158/2326-6066.CIR-21-0593 PubMed 35181792