Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RpHLuorin2
(Plasmid #180227)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180227 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a(+)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    expression in E.coli BL21(DE3)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ratiometric pHLuorin2
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag followed by thrombin cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 180227 ; http://n2t.net/addgene:180227 ; RRID:Addgene_180227)
  • For your References section:

    Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377