pACYC-T7-Nla-repeat-BbsI
(Plasmid
#180215)
-
Purpose(Empty Backbone) For cloning Neisseria lactamica Type I-C crRNA for protein purification in E.Coli
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepACYC
-
Backbone manufacturerNovagen
- Backbone size (bp) 2219
-
Vector typeBacterial Expression, CRISPR
- Promoter T7
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 3′ sequencing primer GACTACCGGAAGCAGTGTGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-T7-Nla-repeat-BbsI was a gift from Yan Zhang (Addgene plasmid # 180215 ; http://n2t.net/addgene:180215 ; RRID:Addgene_180215) -
For your References section:
Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Tan R, Krueger RK, Gramelspacher MJ, Zhou X, Xiao Y, Ke A, Hou Z, Zhang Y. Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19. 10.1016/j.molcel.2021.12.032 PubMed 35051351
Map uploaded by the depositor.
