pET-NlaCascade-NLS-6xHis
(Plasmid #180213)

• Purpose: Expressing Neisseria lactamica Type I-C Cascade subunits (Cas5-Cas8-Cas11-Cas7) with NLS and His tag on the C terminus of Cas7 for protein purification in E.Coli
• Depositing Lab: Yan Zhang
• Publication: Tan et al Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19.

Backbone

• Vector backbone: pET
• Backbone manufacturer: pET-based custom vector
• Backbone size w/o insert (bp): 5203
• Total vector size (bp): 8526
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: NlaCas5-Cas8-Cas7
• Alt name: DR91_RS04460; DR91_RS04455; DR91_RS04450
• Species: Neisseria lactamica
• Insert Size (bp): 3323
• GenBank ID: NZ_KN046803.1
• Promoter: T7
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 6XHis (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET-Nla-Cascade-NLS-6xhis

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry