pRB131
(Plasmid
#180174)
-
PurposepAAV construct GluN1A714L (shRNA resistant)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CW3SL-EGFP
-
Backbone manufacturerAddgene#61463
-
Modifications to backboneEGFP dropped out by NheI and EcoRI. EcoRI site was blunt ended and GluN1 cloned in as a NheI EcoRV fragment.
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGluN1
-
Alt nameGriN1/ NMDAR1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3545
-
MutationA714L
-
Entrez GeneGrin1 (a.k.a. GluN1, NMDAR1, NR1)
-
Tag
/ Fusion Protein
- Phluorin (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer GluN1 SeqF1 CATGGTGTGGGCTGGTTTCG
- 3′ sequencing primer GluN1 SeqR1 TGCAGGTTCTTCCTCCACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB131 was a gift from Richard Bergeron (Addgene plasmid # 180174 ; http://n2t.net/addgene:180174 ; RRID:Addgene_180174) -
For your References section:
Glycine-induced NMDA receptor internalization provides neuroprotection and preserves vasculature following ischemic stroke. Cappelli J, Khacho P, Wang B, Sokolovski A, Bakkar W, Raymond S, Ahlskog N, Pitney J, Wu J, Chudalayandi P, Wong AYC, Bergeron R. iScience. 2021 Dec 3;25(1):103539. doi: 10.1016/j.isci.2021.103539. eCollection 2022 Jan 21. 10.1016/j.isci.2021.103539 PubMed 34977503