Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRB112
(Plasmid #180173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180173 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-CW3SL-EGFP
  • Backbone manufacturer
    Addgene#61463
  • Total vector size (bp) 7291
  • Modifications to backbone
    GluN1 cloned in as NheI-EcoRV fragment. Vector was digested with EcoRI, blunt ended, then digested wtih NheI to dropout EGFP. Vector and insert were then ligated
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GluN1
  • Alt name
    GriN1/ NMDAR1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3545
  • Mutation
    WT
  • Entrez Gene
    Grin1 (a.k.a. GluN1, NMDAR1, NR1)
  • Tag / Fusion Protein
    • Phluorin (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer GluN1 SeqF1 CATGGTGTGGGCTGGTTTCG
  • 3′ sequencing primer GluN1 SeqR1 TGCAGGTTCTTCCTCCACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRB112 was a gift from Richard Bergeron (Addgene plasmid # 180173 ; http://n2t.net/addgene:180173 ; RRID:Addgene_180173)
  • For your References section:

    Glycine-induced NMDA receptor internalization provides neuroprotection and preserves vasculature following ischemic stroke. Cappelli J, Khacho P, Wang B, Sokolovski A, Bakkar W, Raymond S, Ahlskog N, Pitney J, Wu J, Chudalayandi P, Wong AYC, Bergeron R. iScience. 2021 Dec 3;25(1):103539. doi: 10.1016/j.isci.2021.103539. eCollection 2022 Jan 21. 10.1016/j.isci.2021.103539 PubMed 34977503