pRB112
(Plasmid #180173)

• Purpose: pAAV construct GluN1WT (shRNA resistant)
• Depositing Lab: Richard Bergeron
• Publication: Cappelli et al iScience. 2021 Dec 3;25(1):103539. doi: 10.1016/j.isci.2021.103539. eCollection 2022 Jan 21.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-CW3SL-EGFP
• Backbone manufacturer: Addgene#61463
• Total vector size (bp): 7291
• Modifications to backbone: GluN1 cloned in as NheI-EcoRV fragment. Vector was digested with EcoRI, blunt ended, then digested wtih NheI to dropout EGFP. Vector and insert were then ligated
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GluN1
• Alt name: GriN1/ NMDAR1
• Species: R. norvegicus (rat)
• Insert Size (bp): 3545
• Mutation: WT
• Entrez Gene: Grin1 (a.k.a. GluN1, NMDAR1, NR1)
• Tag / Fusion Protein:
  • Phluorin (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: GluN1 SeqF1 CATGGTGTGGGCTGGTTTCG
• 3′ sequencing primer: GluN1 SeqR1 TGCAGGTTCTTCCTCCACAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry