Skip to main content
Addgene

pRB112
(Plasmid #180173)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180173 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CW3SL-EGFP
  • Backbone manufacturer
    Addgene#61463
  • Total vector size (bp) 7291
  • Modifications to backbone
    GluN1 cloned in as NheI-EcoRV fragment. Vector was digested with EcoRI, blunt ended, then digested wtih NheI to dropout EGFP. Vector and insert were then ligated
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GluN1
  • Alt name
    GriN1/ NMDAR1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3545
  • Mutation
    WT
  • Entrez Gene
    Grin1 (a.k.a. GluN1, NMDAR1, NR1)
  • Tag / Fusion Protein
    • Phluorin (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer GluN1 SeqF1 CATGGTGTGGGCTGGTTTCG
  • 3′ sequencing primer GluN1 SeqR1 TGCAGGTTCTTCCTCCACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRB112 was a gift from Richard Bergeron (Addgene plasmid # 180173 ; http://n2t.net/addgene:180173 ; RRID:Addgene_180173)
  • For your References section:

    Glycine-induced NMDA receptor internalization provides neuroprotection and preserves vasculature following ischemic stroke. Cappelli J, Khacho P, Wang B, Sokolovski A, Bakkar W, Raymond S, Ahlskog N, Pitney J, Wu J, Chudalayandi P, Wong AYC, Bergeron R. iScience. 2021 Dec 3;25(1):103539. doi: 10.1016/j.isci.2021.103539. eCollection 2022 Jan 21. 10.1016/j.isci.2021.103539 PubMed 34977503