-
Purpose(Empty Backbone) This plasmid is an empty vector used as the control for other plasmids which are in pT3-EF1aH backbone. It does not have any restriction site for cloning.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepT3-EF1α
- Backbone size (bp) 7000
-
Vector typeMammalian Expression
- Promoter EF1α
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EF-1aforward: TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer pcDNA3.1BGHRev: TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT3-EF1aH was a gift from Xin Chen (Addgene plasmid # 180149 ; http://n2t.net/addgene:180149 ; RRID:Addgene_180149) -
For your References section:
TAZ is indispensable for c-MYC-induced hepatocarcinogenesis. Wang H, Zhang S, Zhang Y, Jia J, Wang J, Liu X, Zhang J, Song X, Ribback S, Cigliano A, Evert M, Liang B, Wu H, Calvisi DF, Zeng Y, Chen X. J Hepatol. 2021 Aug 28. pii: S0168-8278(21)02016-X. doi: 10.1016/j.jhep.2021.08.021. 10.1016/j.jhep.2021.08.021 PubMed 34464659
