Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWZL Hygro-TRF2 deltaB
(Plasmid #18010)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18010 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pWZL Hygro
  • Backbone size w/o insert (bp) 5900
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hTRF2
  • Alt name
    human TTAGGG repeat binding factor 2
  • Alt name
    2456
  • Alt name
    TERF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1368
  • Mutation
    Deleted Basic Domain (aa1-44)
  • Entrez Gene
    TERF2 (a.k.a. TRBF2, TRF2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer AATGCTCGTCAAGAAGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

{Wang et al., 2004, Cell, 119, 355-68}

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL Hygro-TRF2 deltaB was a gift from Titia de Lange (Addgene plasmid # 18010 ; http://n2t.net/addgene:18010 ; RRID:Addgene_18010)
  • For your References section:

    Senescence induced by altered telomere state, not telomere loss. Karlseder J, Smogorzewska A, de Lange T. Science. 2002 Mar 29. 295(5564):2446-9. 10.1126/science.1069523 PubMed 11923537