pWZL Hygro-TRF2 deltaB
(Plasmid #18010)

• Depositing Lab: Titia de Lange
• Publication: Karlseder et al Science. 2002 Mar 29. 295(5564):2446-9.

Backbone

• Vector backbone: pWZL Hygro
• Backbone size w/o insert (bp): 5900
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTRF2
• Alt name: human TTAGGG repeat binding factor 2
• Alt name: 2456
• Alt name: TERF2
• Species: H. sapiens (human)
• Insert Size (bp): 1368
• Mutation: Deleted Basic Domain (aa1-44)
• Entrez Gene: TERF2 (a.k.a. TRBF2, TRF2)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTTTGTACACCCTAAGCCT
• 3′ sequencing primer: AATGCTCGTCAAGAAGAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

{Wang et al., 2004, Cell, 119, 355-68}