Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRO16Sh5
(Plasmid #180076)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180076 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pR01600
  • Backbone size w/o insert (bp) 3359
  • Total vector size (bp) 9013
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ShTnsB, ShTnsC, ShTniQ, ShCas12k
  • Species
    Scytonema hofmannii
  • Insert Size (bp)
    5988
  • Promoter pLac

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCTGGCCTTTTGCTCAACG
  • 3′ sequencing primer CACGACAGGTTTCCCGACTGGAAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid #127921 - pHelper_ShCAST_sgRNA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The vector backbone was derived from plasmid pFlpe2 from

Choi, K. H., Mima, T., Casart, Y., Rholl, D., Kumar, A., Beacham, I. R., & Schweizer, H. P. (2008). Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei. Applied and environmental microbiology, 74(4), 1064–1075. https://doi.org/10.1128/AEM.02430-07

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRO16Sh5 was a gift from Christopher Reisch (Addgene plasmid # 180076 ; http://n2t.net/addgene:180076 ; RRID:Addgene_180076)
  • For your References section:

    CRISPR-Associated Transposase for Targeted Mutagenesis in Diverse Proteobacteria. Trujillo Rodriguez L, Ellington AJ, Reisch CR, Chevrette MG. ACS Synth Biol. 2023 Jun 27. doi: 10.1021/acssynbio.3c00065. 10.1021/acssynbio.3c00065 PubMed 37368499