pRO16Sh5
(Plasmid
#180076)
-
PurposeExpression of ShCAST under control of Plac with pRO1600 origin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepR01600
- Backbone size w/o insert (bp) 3359
- Total vector size (bp) 9013
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShTnsB, ShTnsC, ShTniQ, ShCas12k
-
SpeciesScytonema hofmannii
-
Insert Size (bp)5988
- Promoter pLac
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCTGGCCTTTTGCTCAACG
- 3′ sequencing primer CACGACAGGTTTCCCGACTGGAAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid #127921 - pHelper_ShCAST_sgRNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector backbone was derived from plasmid pFlpe2 from
Choi, K. H., Mima, T., Casart, Y., Rholl, D., Kumar, A., Beacham, I. R., & Schweizer, H. P. (2008). Genetic tools for select-agent-compliant manipulation of Burkholderia pseudomallei. Applied and environmental microbiology, 74(4), 1064–1075. https://doi.org/10.1128/AEM.02430-07
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRO16Sh5 was a gift from Christopher Reisch (Addgene plasmid # 180076 ; http://n2t.net/addgene:180076 ; RRID:Addgene_180076) -
For your References section:
CRISPR-Associated Transposase for Targeted Mutagenesis in Diverse Proteobacteria. Trujillo Rodriguez L, Ellington AJ, Reisch CR, Chevrette MG. ACS Synth Biol. 2023 Jun 27. doi: 10.1021/acssynbio.3c00065. 10.1021/acssynbio.3c00065 PubMed 37368499