Skip to main content
Addgene

pT3EF5a-PIK3CA H1047R
(Plasmid #180034)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180034 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 2700
  • Vector type
    Mammalian Expression ; Entry Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PIK3CA H1047R
  • Alt name
    phosphoinositide 3-kinase
  • Alt name
    PI3K
  • Alt name
    p110 alpha
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3207
  • Mutation
    H1047R
  • GenBank ID
    NM_006218.4
  • Entrez Gene
    PIK3CA (a.k.a. CCM4, CLAPO, CLOVE, CWS5, HMH, MCAP, MCM, MCMTC, PI3K, PI3K-alpha, p110-alpha)
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTA
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    HA-PIK3CAH1047R was cloned from Addgene #12524: pBabe-HA-PIK3CAH1047R

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct contains LoxP sequences flanking the pT3 sequences. Therefore, this plasmid could not be use in combination with CRE in the studies.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT3EF5a-PIK3CA H1047R was a gift from Xin Chen (Addgene plasmid # 180034 ; http://n2t.net/addgene:180034 ; RRID:Addgene_180034)
  • For your References section:

    Activated mutant forms of PIK3CA cooperate with RasV12 or c-Met to induce liver tumor formation in mice via AKT2/mTORC1 cascade. Wang C, Che L, Hu J, Zhang S, Jiang L, Latte G, Demartis MI, Tao J, Gui B, Pilo MG, Ribback S, Dombrowski F, Evert M, Calvisi DF, Chen X. Liver Int. 2015 Dec 30. doi: 10.1111/liv.13055. 10.1111/liv.13055 PubMed 26716908