pBPK1520-HEK3-CTTins-ng
(Plasmid #180019)

• Purpose: Transiently expressing a nicking sgRNA to facilitate the introduction of HEK3 CTT insertion in PE3 approach
• Depositing Lab: Dirk Hockemeyer
• Publication: Li et al Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208.

Backbone

• Vector backbone: BPK1520
• Backbone manufacturer: Keith Joung (Addgene plasmid # 65777)
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Prime editing ngRNA for HEK3-CTTins
• gRNA/shRNA sequence: GTCAACCAGTATCCCGGTGC
• Species: H. sapiens (human)
• Insert Size (bp): 21
• Entrez Gene: EPHA8 (a.k.a. EEK, EK3, HEK3)
• Promoter: Human U7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: hU6-F (GAGGGCCTATTTCCCATGATT)

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• A portion of this plasmid was derived from a plasmid made by: Backbone is from Keith Joung (Addgene plasmid # 65777)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry