pBPK1520-SNCA-A30P-ng
(Plasmid #180018)

• Purpose: Transiently expressing a nicking sgRNA to facilitate the introduction of SNCA-A30P mutation in PE3 approach
• Depositing Lab: Dirk Hockemeyer
• Publication: Li et al Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208.

Backbone

• Vector backbone: BPK1520
• Backbone manufacturer: Keith Joung (Addgene plasmid # 65777)
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Prime editing ngRNA for SNCA-A30P
• gRNA/shRNA sequence: ACAAGCACCAAACTGACATT
• Species: H. sapiens (human)
• Insert Size (bp): 21
• Entrez Gene: SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
• Promoter: Human U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: hU6-F (GAGGGCCTATTTCCCATGATT)

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• A portion of this plasmid was derived from a plasmid made by: Backbone is from Keith Joung (Addgene plasmid # 65777)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry