pU6-pegRNA-SNCA-A30P
(Plasmid #180016)

• Purpose: Transiently expressing a pegRNA to introduce SNCA-A30P mutation in human cells
• Depositing Lab: Dirk Hockemeyer
• Publication: Li et al Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208.

Backbone

• Vector backbone: pU6-pegRNA-GG-acceptor
• Backbone manufacturer: David Liu (Addgene plasmid # 132777)
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Prime editing pegRNA for SNCA-A30P
• gRNA/shRNA sequence: GCAGGGTGTGGCAGAAGCAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTCTTTCCTGGTGCTTCTGCCACACC
• Species: Synthetic
• Insert Size (bp): 123
• Entrez Gene: SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
• Promoter: Human U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: hU6-F (GAGGGCCTATTTCCCATGATT)

Resource Information

• Supplemental Documents:
  • Annotated Genbank file
• A portion of this plasmid was derived from a plasmid made by: Backbone is from David Liu (Addgene plasmid # 132777)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry