pET30a(+)-PE2
(Plasmid
#180015)
-
PurposeExpressing PE2 protein in E.coli for protein purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET30a(+)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE2
-
SpeciesSynthetic
-
Insert Size (bp)6350
- Promoter Lac operator-controlled T7 promoter
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7 promoter, forward primer (TAATACGACTCACTATAGGG)
- 3′ sequencing primer T7 terminator, reverse primer (GCTAGTTATTGCTCAGCGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30a(+)-PE2 was a gift from Dirk Hockemeyer (Addgene plasmid # 180015 ; http://n2t.net/addgene:180015 ; RRID:Addgene_180015) -
For your References section:
Highly efficient generation of isogenic pluripotent stem cell models using prime editing. Li H, Busquets O, Verma Y, Syed KM, Kutnowski N, Pangilinan GR, Gilbert LA, Bateup HS, Rio DC, Hockemeyer D, Soldner F. Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208. 10.7554/eLife.79208 PubMed 36069759