GFP-Bcl2-Maob
(Plasmid #18001)

• Depositing Lab: Clark Distelhorst
• Publication: Wang et al J Biol Chem. 2001 Nov 23. 276(47):44117-28.

Backbone

• Vector backbone: pEMD-C1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mitochondria-targeted Bcl-2
• Alt name: Bcl-2 Maob
• Alt name: Bcl-2 Monoamine oxidase B
• Alt name: Bcl-2
• Species: H. sapiens (human)
• Insert Size (bp): 746
• Mutation: Bcl-2's C terminal replaced with mitochondria-targeted sequence (LLRLIGLTTIFSATALGFLAHKRGLLVRV)
• Entrez Gene: BCL2 (a.k.a. Bcl-2, PPP1R50)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (not destroyed)
• 3′ cloning site: Sal I (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: PCR amplified Bcl-2 from pB4 plasmid purchased from ATCC. PCR amplified Maob from EST purchased from Genome Systems
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry