pAAV-hSyn-GRAB_NTS1.0
(Plasmid
#180006)
-
PurposeExpresses the neurotensin sensor GRAB_NTS1.0 in neurons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4495
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameneurotensin sensor GRAB_NTS1.0
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)2127
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer F_hSyn_IgK: GAGAGCGCAGTCGAGAAACCGGTGCCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-GRAB_NTS1.0 was a gift from Yulong Li (Addgene plasmid # 180006 ; http://n2t.net/addgene:180006 ; RRID:Addgene_180006)