Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUASt-GBP-Trbo
(Plasmid #179996)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 179996 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUASt-attB-K10
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 10500
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GBP nanobody
  • Species
    Synthetic
  • Insert Size (bp)
    824
  • Tag / Fusion Protein
    • Trbo (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer CCAGCAACCAAGTAAATCAACTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUASt-GBP-Trbo was a gift from Graydon Gonsalvez (Addgene plasmid # 179996 ; http://n2t.net/addgene:179996 ; RRID:Addgene_179996)
  • For your References section:

    In vivo proximity biotin ligation identifies the interactome of Egalitarian, a Dynein cargo adaptor. Baker FC, Neiswender H, Veeranan-Karmegam R, Gonsalvez GB. Development. 2021 Nov 15;148(22). pii: 273472. doi: 10.1242/dev.199935. Epub 2021 Nov 18. 10.1242/dev.199935 PubMed 35020877