pUASp-GBP-Tbro
(Plasmid
#179995)
-
PurposeExpresses two tandem copies of the GFP nanobody fused at the C-terminus with TurboID. Expression is driven using the UAS-Gal4 system. The UASp version is ideal for expression in the germline.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 179995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUASp-attB-K10
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 12000
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGBP nanobody
-
SpeciesSynthetic
-
Insert Size (bp)824
- Promoter UAS-Gal4
-
Tag
/ Fusion Protein
- Trbo (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer GCACGTTTGCTTGTTGAGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUASp-GBP-Tbro was a gift from Graydon Gonsalvez (Addgene plasmid # 179995 ; http://n2t.net/addgene:179995 ; RRID:Addgene_179995) -
For your References section:
In vivo proximity biotin ligation identifies the interactome of Egalitarian, a Dynein cargo adaptor. Baker FC, Neiswender H, Veeranan-Karmegam R, Gonsalvez GB. Development. 2021 Nov 15;148(22). pii: 273472. doi: 10.1242/dev.199935. Epub 2021 Nov 18. 10.1242/dev.199935 PubMed 35020877
