-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEMD-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBcl-2
-
Alt nameBcl2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)720
-
Entrez GeneBCL2 (a.k.a. Bcl-2, PPP1R50)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site Eco RI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman Bcl-2 was PCR amplified from pB4 plasmid purchased from ATCC
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Bcl2 was a gift from Clark Distelhorst (Addgene plasmid # 17999 ; http://n2t.net/addgene:17999 ; RRID:Addgene_17999) -
For your References section:
Transient expression of wild-type or mitochondrially targeted Bcl-2 induces apoptosis, whereas transient expression of endoplasmic reticulum-targeted Bcl-2 is protective against Bax-induced cell death. Wang NS, Unkila MT, Reineks EZ, Distelhorst CW. J Biol Chem. 2001 Nov 23. 276(47):44117-28. 10.1074/jbc.M101958200 PubMed 11546793