pLNC Wnt-4
(Plasmid
#17995)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLNC
- Backbone size w/o insert (bp) 6620
-
Vector typeRetroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a, HB101
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameWnt-4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1300
-
Entrez GeneWnt4 (a.k.a. Wnt-4)
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATCG
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gavin, B.J., McMahon, J.A., and McMahon, A.P. Expression of multiple novel Wnt-1/Int-1-related genes during fetal and adult mouse development. Genes Dev.,4:2319-2332, 1990.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLNC Wnt-4 was a gift from Jan Kitajewski (Addgene plasmid # 17995 ; http://n2t.net/addgene:17995 ; RRID:Addgene_17995) -
For your References section:
Transformation by Wnt family proteins correlates with regulation of beta-catenin. Shimizu H, Julius MA, Giarre M, Zheng Z, Brown AM, Kitajewski J. Cell Growth Differ. 1997 Dec . 8(12):1349-58. PubMed 9419423